agpat4

Ensembl ID:
ENSDARG00000069044
ZFIN ID:
ZDB-GENE-040426-1924
Description:
1-acyl-sn-glycerol-3-phosphate acyltransferase delta [Source:RefSeq peptide;Acc:NP_998157]
Human Orthologue:
AGPAT4
Human Description:
1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) [Sourc
Mouse Orthologue:
Agpat4
Mouse Description:
1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Gene [

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35549 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa2710 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa35549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100156 Splice Site, Nonsense 60 377 2 9
Genomic Location:
Chromosome 13 (position 36174602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCTCGCACGCAAGATCAACTGCAGACTGGGTTACTCCATCGCTAGT[C/T]GTAAGTCCTGCAAAATGTTCTTTTGTTTGTTTAACTTGATGTACTTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2710
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100156 Nonsense 145 377 4 9
Genomic Location:
Chromosome 13 (position 36176850)
KASP Assay ID:
554-3315.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTCCTGTGATTGGCTGGATGTGGTATTTCCTGGAGATTGTCTTCTGC[A/T]AAAGGAAATGGGAAGAGGATCGCAAKACAGTCGTGCAGAGTCTGCGCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link