cyp7a1a

Ensembl ID:
ENSDARG00000069018
ZFIN ID:
ZDB-GENE-040426-1296
Description:
cholesterol 7-alpha-monooxygenase [Source:RefSeq peptide;Acc:NP_957467]
Human Orthologue:
CYP7A1
Human Description:
cytochrome P450, family 7, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2651]
Mouse Orthologue:
Cyp7a1
Mouse Description:
cytochrome P450, family 7, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:106091]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32901 Nonsense Mutation detected in F1 DNA During 2016
sa38326 Nonsense Mutation detected in F1 DNA During 2016
sa32900 Nonsense Mutation detected in F1 DNA During 2016
sa19734 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100069 Nonsense 100 558 2 6
ENSDART00000145188 Nonsense 54 512 2 6
Genomic Location:
Chromosome 2 (position 21948927)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGGATTCCCTTCCTTGGCTGTGCTCTTCAGTTTGGGGCAAATCCTT[T/A]AGAGTTTCTTCGCAGCAGACAGAAGAAGCATGGCCATATTTTTACATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100069 Nonsense 154 558 2 6
ENSDART00000145188 Nonsense 108 512 2 6
Genomic Location:
Chromosome 2 (position 21948766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAGGAAGGCACCTTGACTGGAAGAAATTTCACTTTGATGCCTCTGCG[A/T]AGGTAAATGAAATAACATTTGCTATGCTATGTTATATGCTACAGCAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32900
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100069 Nonsense 213 558 3 6
ENSDART00000145188 Nonsense 167 512 3 6
Genomic Location:
Chromosome 2 (position 21948468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGCACCATGCTGCAATCTGGAATGTTGAAGGCCACAACCTCTGAATG[G/A]CAAAGTGATGGTATTTACGCCTTCTGCTACAAGGTCATGTTTGAAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100069 Nonsense 259 558 3 6
ENSDART00000145188 Nonsense 213 512 3 6
Genomic Location:
Chromosome 2 (position 21948331)
KASP Assay ID:
2259-1896.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAGCATTGCACGTCAGCAGGCCCAAAAGGCTCTGGTGCTCAATGCTT[T/A]GGACAACTTTAAAGAGTTCGATAAGATCTTCCCAGCTCTGATCGCTGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link