cyp7a1a

Ensembl ID:
ENSDARG00000069018
ZFIN ID:
ZDB-GENE-040426-1296
Description:
cholesterol 7-alpha-monooxygenase [Source:RefSeq peptide;Acc:NP_957467]
Human Orthologue:
CYP7A1
Human Description:
cytochrome P450, family 7, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2651]
Mouse Orthologue:
Cyp7a1
Mouse Description:
cytochrome P450, family 7, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:106091]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19734 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100069 Nonsense 259 558 3 6
ENSDART00000145188 Nonsense 213 512 3 6
Genomic Location:
Chromosome 2 (position 21948331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAGCATTGCACGTCAGCAGGCCCAAAAGGCTCTGGTGCTCAATGCTT[T/A]GGACAACTTTAAAGAGTTCGATAAGATCTTCCCAGCTCTGATCGCTGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6m38vgqp