si:dkey-202c5.1

Ensembl ID:
ENSDARG00000069014
ZFIN ID:
ZDB-GENE-060503-715
Description:
hypothetical protein LOC560234 [Source:RefSeq peptide;Acc:NP_001124247]
Human Orthologue:
NPHP4
Human Description:
nephronophthisis 4 [Source:HGNC Symbol;Acc:19104]
Mouse Orthologue:
Nphp4
Mouse Description:
nephronophthisis 4 (juvenile) homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2384210]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41188 Nonsense Mutation detected in F1 DNA During 2017
sa1369 Essential Splice Site Available for shipment Available now
sa7132 Nonsense Mutation detected in F1 DNA During 2017
sa38686 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100063 Nonsense 444 1416 10 29
ENSDART00000121513   None 139 None 3
ENSDART00000131805 Nonsense 445 825 10 17
ENSDART00000147145   None 520 None 10
Genomic Location (Zv9):
Chromosome 8 (position 22716962)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22088138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTCTGGGAAATGTGTCATCAAATTGAAGTTTTCATCTAGTGCAGAA[G/T]GAGTTTCTAGCAGCGCGGCATTGAAAGTGAGCCACCAAGAAACATCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100063 Essential Splice Site 583 1416 13 29
ENSDART00000121513   None 139 None 3
ENSDART00000131805 Essential Splice Site 584 825 13 17
ENSDART00000147145   None 520 None 10
Genomic Location (Zv9):
Chromosome 8 (position 22670521)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22041697
KASP Assay ID:
554-1281.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCCCGGTGCACGCGCCTGTCATCACCCTCGGGACAAACGCTGCTGG[G/A]TGAGAAACATACAGACCTACAGCAACAAACAGTCCTRCACTACAGKGATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa7132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100063 Nonsense 586 1416 14 29
ENSDART00000121513   None 139 None 3
ENSDART00000131805 Nonsense 587 825 14 17
ENSDART00000147145   None 520 None 10
Genomic Location (Zv9):
Chromosome 8 (position 22662325)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22033501
KASP Assay ID:
554-5180.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYAACCAGTCTTTAAGTGTGCAAATGTGATTTGTGTATCTCAGCTCCTCC[A/T]GATCGACCTCCCGGAGATCTTTGGCGCAGCTCTTCTCTGCTGGTTTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100063 Essential Splice Site 764 1416 16 29
ENSDART00000121513   None 139 None 3
ENSDART00000131805 Essential Splice Site 765 825 16 17
ENSDART00000147145   None 520 None 10
Genomic Location (Zv9):
Chromosome 8 (position 22641316)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 22012492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACAGTGATTCCTTAATGCTGATTGGCTCAGCTGCTGTGGAGCTGAAG[G/A]TAGAACTGCCTATATACACATAGGTCCAAAAATGCTCTTTTTTGAGGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link