gro1

Ensembl ID:
ENSDARG00000069006
ZFIN ID:
ZDB-GENE-990415-85
Description:
Protein groucho-1 [Source:UniProtKB/Swiss-Prot;Acc:O13168]
Human Orthologue:
TLE3
Human Description:
transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) [Source:HGNC Symbol;Acc:11839]
Mouse Orthologue:
Tle3
Mouse Description:
transducin-like enhancer of split 3, homolog of Drosophila E(spl) Gene [Source:MGI Symbol;Acc:MGI:10

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20989 Nonsense Mutation detected in F1 DNA During 2014
sa13620 Essential Splice Site Available for shipment Available now
sa17548 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100020 Nonsense 325 771 12 20
ENSDART00000130553 Nonsense 325 771 13 21

The following transcripts of ENSDARG00000069006 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 34989403)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCTCCATTCCTTCATCTCGCAGAACGACAAGTCCTCCACCCCAGGTT[T/A]GAAGTCCAACACCCCTACCCCACGCAACGACGCTCCCACCCCAGGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100020 Essential Splice Site 660 771 17 20
ENSDART00000130553 Essential Splice Site 660 771 18 21

The following transcripts of ENSDARG00000069006 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 34984409)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGACCTGAGAGAGGGTCGCCAGCTTCAGCAGCATGACTTCACAYCACAG[G/A]TTATCTTAATGCACACTTATACACCTYAAAAATGCACTTGTAATKGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100020 Nonsense 701 771 18 20
ENSDART00000130553 Nonsense 701 771 19 21

The following transcripts of ENSDARG00000069006 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 34983762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCATCACACCAAGCCTGACAAGTACCAGCTGCACCTGCACGAGAGCTG[T/A]GTCCTCTCCCTCAAATTTGCYTACTGTGGTAAGACGCTGTTACTTTACCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/340uf2hh