si:ch211-223g7.7

Ensembl ID:
ENSDARG00000068997
ZFIN ID:
ZDB-GENE-050420-18
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S716]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20309 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123805 Nonsense 943 1032 7 7
ENSDART00000133024   None 589 None 1

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 45388849)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 52425962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAGGGAGGAGGTGCTGAGTGTGTGTTTGGATGTAATGCTCAGTCCTG[G/A]AGTTTGAGCTGCTCTTCCTCCAGTTTCTCATTCAGACACAATATCACACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link