hist2h2l

Ensembl ID:
ENSDARG00000068996
ZFIN IDs:
ZDB-GENE-031118-36, ZDB-GENE-071004-32
Description:
Histone H2B 3 [Source:UniProtKB/Swiss-Prot;Acc:Q6PC60]
Human Orthologues:
HIST1H2BA, HIST2H2BE
Human Descriptions:
histone cluster 1, H2ba [Source:HGNC Symbol;Acc:18730]
histone cluster 2, H2be [Source:HGNC Symbol;Acc:4760]
Mouse Orthologue:
Hist1h2ba
Mouse Description:
histone cluster 1, H2ba Gene [Source:MGI Symbol;Acc:MGI:2448375]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34932 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055913 Nonsense 48 126 1 1
Genomic Location (Zv9):
Chromosome 10 (position 30724043)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29929946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGACCAGGAAAGAGAGTTACGCCATTTACGTGTACAAAGTACTAAAA[C/T]AAGTCCACCCGGACACTGGCATCTCCTCAAAGGCGATGGGCATTATGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link