hspa8

Ensembl ID:
ENSDARG00000068992
ZFIN ID:
ZDB-GENE-990415-92
Description:
Heat shock cognate 71 kDa protein [Source:UniProtKB/Swiss-Prot;Acc:Q90473]
Human Orthologue:
HSPA8
Human Description:
heat shock 70kDa protein 8 [Source:HGNC Symbol;Acc:5241]
Mouse Orthologue:
Hspa8
Mouse Description:
heat shock protein 8 Gene [Source:MGI Symbol;Acc:MGI:105384]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41685 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099994 Nonsense 574 649 8 9
ENSDART00000132212   None 188 None 5
ENSDART00000141549   None 127 None 3
Genomic Location (Zv9):
Chromosome 10 (position 30760833)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29966736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAAGGGCAAGATCAGTGACGAGGACAAACAGAAGATTCTTGACAAGTG[T/A]AATGAAGTCATCGGCTGGCTTGACAAGAACCAGGTGAACTTGCTGTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link