gabra1

Ensembl ID:
ENSDARG00000068989
ZFIN ID:
ZDB-GENE-061013-194
Description:
gamma-aminobutyric acid receptor subunit alpha-1 [Source:RefSeq peptide;Acc:NP_001070794]
Human Orthologue:
GABRA1
Human Description:
gamma-aminobutyric acid (GABA) A receptor, alpha 1 [Source:HGNC Symbol;Acc:4075]
Mouse Orthologue:
Gabra1
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95613]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43718 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43718
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100000 Nonsense 200 459 6 9
ENSDART00000144767   None 174 None 2
Genomic Location (Zv9):
Chromosome 21 (position 40707324)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 42063122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTCGGCAGATGCCTACACCAGAGCTGAAGTGGTGTACGTTTGGACT[C/T]GAGGGGCGGCGCAGTCCGTGGTCGTGGCTGACGATGGTTCTCGTCTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link