btbd9

Ensembl ID:
ENSDARG00000068983
ZFIN ID:
ZDB-GENE-040704-39
Description:
BTB (POZ) domain containing 9-like [Source:RefSeq peptide;Acc:NP_001157304]
Human Orthologue:
BTBD9
Human Description:
BTB (POZ) domain containing 9 [Source:HGNC Symbol;Acc:21228]
Mouse Orthologue:
Btbd9
Mouse Description:
BTB (POZ) domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1916625]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31963 Essential Splice Site Available for shipment Available now
sa35580 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074765 Essential Splice Site 62 602 None 10
ENSDART00000099990 Essential Splice Site 62 602 None 11
ENSDART00000141298 Essential Splice Site 62 183 None 3
Genomic Location (Zv9):
Chromosome 13 (position 45398574)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44642073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTCCTGCACACAGGGTCATTCTAGCGGCCCGCTGCCAGTATTTCAGG[T/A]TTGTGAGATGATATCACTTGTCTGTTGGGCTGATTTTGGGTGAAATCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074765 Essential Splice Site 487 602 7 10
ENSDART00000099990 Essential Splice Site 487 602 8 11
ENSDART00000141298   None 183 None 3
Genomic Location (Zv9):
Chromosome 13 (position 45389929)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44633428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCATCGTCATCCAGCTTGCTCAGCCATACATGCTTTGCTCCATGCGG[T/C]ATTTTGTTTATCACAAGAGTTATTATTATTATGATGTCTTAAATGTTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link