glo1

Ensembl ID:
ENSDARG00000068978
ZFIN ID:
ZDB-GENE-030722-9
Description:
lactoylglutathione lyase [Source:RefSeq peptide;Acc:NP_998316]
Human Orthologue:
GLO1
Human Description:
glyoxalase I [Source:HGNC Symbol;Acc:4323]
Mouse Orthologue:
Glo1
Mouse Description:
glyoxalase 1 Gene [Source:MGI Symbol;Acc:MGI:95742]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35581 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35581
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099984 Nonsense 70 180 3 6
Genomic Location (Zv9):
Chromosome 13 (position 45423929)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 44667428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGTTTGATTTCCCCTCGATGCGCTTCACCCTCTACTTTCTGGGTTA[C/A]GAAGATAAGAAAGAGATCCCTGCAGATGTGAAGGAGAGGACGGCCTGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link