pdlim4

Ensembl ID:
ENSDARG00000068973
ZFIN ID:
ZDB-GENE-070308-5
Description:
PDZ and LIM domain protein 4 [Source:RefSeq peptide;Acc:NP_001036161]
Human Orthologue:
PDLIM4
Human Description:
PDZ and LIM domain 4 [Source:HGNC Symbol;Acc:16501]
Mouse Orthologue:
Pdlim4
Mouse Description:
PDZ and LIM domain 4 Gene [Source:MGI Symbol;Acc:MGI:1353470]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9735 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099978 Nonsense 320 349 7 7

The following transcripts of ENSDARG00000068973 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 42144818)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43743864
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCTCAACCTGAAGCAGAGAGGATATTTCTTCATMGATGACAATCTGTA[T/A]TGTGAGACCCACGCCAAGGCCCGYGTCCAGCCYCCTGAGGGCTACGAYGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link