nrip1a

Ensembl ID:
ENSDARG00000068965
ZFIN ID:
ZDB-GENE-040723-8
Description:
RIP140-A [Source:UniProtKB/TrEMBL;Acc:Q1L666]
Human Orthologue:
NRIP1
Human Description:
nuclear receptor interacting protein 1 [Source:HGNC Symbol;Acc:8001]
Mouse Orthologue:
Nrip1
Mouse Description:
nuclear receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1315213]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22669 Nonsense Available for shipment Available now
sa22670 Nonsense Available for shipment Available now
sa6382 Nonsense Mutation detected in F1 DNA During 2017
sa32041 Nonsense Available for shipment Available now
sa5882 Nonsense Mutation detected in F1 DNA During 2017
sa6383 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 286 1044 1 1
ENSDART00000135540 Nonsense 286 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29059331)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29777361
KASP Assay ID:
2260-8650.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCAACAGTATTCTCGAGAGCATGCCCTGAAAGCCAAACTTTCTGGA[C/T]GATCAGCCAGTGAAAGACTATCTGCCATGGCCACACAACAGACACCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22670
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 371 1044 1 1
ENSDART00000135540 Nonsense 371 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29059588)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29777618
KASP Assay ID:
2260-8651.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGAGCGTCGACCTTTCGAAAAACAAGGCAGACCATCACAGAATTG[T/A]AGCAGTCTTCTTCTTCAGCTTCTTAACAGTCACAACACCTCACAGCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 889 1044 1 1
ENSDART00000135540 Nonsense 889 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061140)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779170
KASP Assay ID:
554-5282.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATAAAAGAAGACAATGGTAGTTATTTTGCCACTGAAGGTCTAGAGACT[A/T]GAGAAGCMAGAGACCCAYCTAGCCCCCCTGAGGCAGACAGTCCACCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 910 1044 1 1
ENSDART00000135540 Nonsense 910 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061205)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCTAGCCCCCCTGAGGCAGACAGTCCACCAGCTAGGTTTCCACCGTA[T/A]GAGTCTAACGAAAACCGAAGTTTCAATGTTTTAAAGCAGCTGCTTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956 Nonsense 964 1044 1 1
ENSDART00000135540 Nonsense 964 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061365)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779395
KASP Assay ID:
554-3682.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGTTGAATGGAAATACAATCAAGCAACCATGCAATGGAGGTGAGCAT[C/T]AAAACCTTCAMAGAAGTCTGAGCCCCAGCAGTGCTTCTTCTAAAAAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099956   None 1044 None 1
ENSDART00000135540 Nonsense 1062 1080 2 2
Genomic Location (Zv9):
Chromosome 15 (position 29061659)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29779689
KASP Assay ID:
554-4408.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATGCACAACTGGTTAAAGAGGGGGAGGGACTAGAGGTAGGCTYGGGA[C/T]AAATGCAGACAAAGGTCAAAAATGAGTCATCAGGTGATACTGAGGCCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link