si:ch211-264e16.1

Ensembl ID:
ENSDARG00000068947
ZFIN ID:
ZDB-GENE-060503-226
Description:
Novel protein similar to non-vertebrate chitin synthase protein [Source:UniProtKB/TrEMBL;Acc:Q1L8X6]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2957 Nonsense Available for shipment Available now
sa1623 Essential Splice Site Available for shipment Available now
sa747 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099921   None 164 None 5
ENSDART00000131524 Nonsense 652 1165 9 17
Genomic Location (Zv9):
Chromosome 18 (position 15392355)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15744767
KASP Assay ID:
554-2717.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAGATGACCAAAGTAATTTCTTCTCTTCGATTTTAGGACCAGTGGTGTG[G/A]TATCAAAAGTTTRAATATGCTGTAGGCCACTGGCTACAAAAGACTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099921   None 164 None 5
ENSDART00000131524 Essential Splice Site 869 1165 11 17
Genomic Location (Zv9):
Chromosome 18 (position 15394919)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15747331
KASP Assay ID:
554-1564.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCTTCTCTATGCATTTCTGATGGCAGGAACAGTTCTCTCCATCATTG[G/A]TAATGACTGTGTTTTAAATGCAATTTTGAAAAATACCATATGATATAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099921   None 164 None 5
ENSDART00000131524 Essential Splice Site 999 1165 13 17
Genomic Location (Zv9):
Chromosome 18 (position 15395872)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15748284
KASP Assay ID:
554-0654.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATAGCTGTAAGATTATTTCTAATATTGATATYGTATTCTTCCTATGTA[G/C]TGCAAAYGACTTCGCAATCAATACTCATAAAAGTATGTATTTTAATATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link