si:ch211-218m3.11

Ensembl ID:
ENSDARG00000068937
ZFIN ID:
ZDB-GENE-091116-45

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15130 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099884 Nonsense 52 314 1 2
ENSDART00000142204 Nonsense 52 309 1 1
Genomic Location (Zv9):
Chromosome 21 (position 39097752)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40237817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTGCAATGRTATCAAATGCTGGACTTATATTTCTGATATCAACAGAC[A/T]AGAATCTGCATGAACCTATGCATTTTCTGTTCTGTAACTTRCCRCTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link