si:ch211-137a8.2

Ensembl ID:
ENSDARG00000068926
ZFIN ID:
ZDB-GENE-061103-172
Description:
hypothetical protein LOC777613 [Source:RefSeq peptide;Acc:NP_001071189]
Human Orthologue:
CLMN
Human Description:
calmin (calponin-like, transmembrane) [Source:HGNC Symbol;Acc:19972]
Mouse Orthologue:
Clmn
Mouse Description:
calmin Gene [Source:MGI Symbol;Acc:MGI:2136957]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11061 Nonsense Available for shipment Available now
sa409 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099856 Nonsense 222 291 5 12
ENSDART00000131755   None 199 None 4
ENSDART00000141164 Nonsense 161 166 4 4
ENSDART00000144126 Nonsense 222 632 5 13

The following transcripts of ENSDARG00000068926 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28396684)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29114714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCCAGCGGGAGGATTTCGAGAGGCAGAGGGAAGAGATGGCGGTCTGGT[T/A]GGCTGAWATGGACCTCAGGCTGACTGAAGTGGAGCATTTCTCGGGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099856 Nonsense 240 291 6 12
ENSDART00000131755   None 199 None 4
ENSDART00000141164   None 166 None 4
ENSDART00000144126 Missense 345 632 7 13

The following transcripts of ENSDARG00000068926 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28403093)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29121123
KASP Assay ID:
554-0268.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCCTCTGAGAGTTTGCTGGAGGACGAGGGCTTCATGGAAAAGATCATG[G/A]CTCCTTTTCCTCAGTCCAGTCACGATCAGCTGGTTCTGGAGTGGGACCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link