si:ch73-19n18.2

Ensembl ID:
ENSDARG00000068923
ZFIN ID:
ZDB-GENE-091204-140
Description:
LOC567806 protein [Source:UniProtKB/TrEMBL;Acc:A1L2F9]
Human Orthologue:
UMODL1
Human Description:
uromodulin-like 1 [Source:HGNC Symbol;Acc:12560]
Mouse Orthologue:
Umodl1
Mouse Description:
uromodulin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1929785]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10685 Essential Splice Site Available for shipment Available now
sa30942 Nonsense Mutation detected in F1 DNA During 2017
sa10242 Essential Splice Site Available for shipment Available now
sa27634 Nonsense Mutation detected in F1 DNA During 2017
sa18380 Nonsense Available for shipment Available now
sa41690 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Essential Splice Site 106 950 2 17
ENSDART00000126952 Essential Splice Site 106 927 2 16
Genomic Location (Zv9):
Chromosome 10 (position 33590793)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32692142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGACATGTTGCCATGGCTAMGAACAAGTTGGTAGTTACTGTGCCTTGC[G/A]TRAGTATKTTCAACTAAATCAGAGTGAAAGTGGAAAGTGAAGGAATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30942
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Nonsense 198 950 4 17
ENSDART00000126952 Nonsense 198 927 4 16
Genomic Location (Zv9):
Chromosome 10 (position 33590347)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32691696
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAACCTATGAGCTATTGGCAATCGACAAAGGTCTCTTGAACCACACC[A/T]GACTGCTTCACTCTGTGGTTTGTAATCATTTGCTGTATAAAGTGCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Essential Splice Site 569 950 11 17
ENSDART00000126952 Essential Splice Site 546 927 10 16
Genomic Location (Zv9):
Chromosome 10 (position 33580191)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32681540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGRATACAYAGACTTGAACCCCAGAAGACCGGGACGCAGCTGTGCAGG[T/C]ACACACTGTGGAAAACGCTACTGTWGAGATTTCATTAGACTGGCACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27634
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Nonsense 674 950 12 17
ENSDART00000126952 Nonsense 651 927 11 16
Genomic Location (Zv9):
Chromosome 10 (position 33577070)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32678419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGAGATTACCTCAAGGCCAATAACATCTCAGAGACCTCCTTGTATCTT[G/T]GAAATCCTGAATGCGGGCCCGTTGGGTTTGATGATTCTTATTTGTGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Nonsense 900 950 16 17
ENSDART00000126952 Nonsense 877 927 15 16
Genomic Location (Zv9):
Chromosome 10 (position 33568742)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32670091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTGACCGTCTTCTAAGTGCCAGGTCTTCTAAATTATTTGGACTGACC[C/T]GATCYGTTGGACCCTTAAACAGATTACACACAAGTAAATGCTTYTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099853 Essential Splice Site 910 950 16 17
ENSDART00000126952 Essential Splice Site 887 927 15 16
Genomic Location (Zv9):
Chromosome 10 (position 33568708)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32670057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTTGGACTGACCCGATCCGTTGGACCCTTAAACAGATTACACACAA[G/A]TAAATGCTTTTTATTTAATGCATGTGAATATCCACAGCCTTCCATGATAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link