hfm1

Ensembl ID:
ENSDARG00000068922
ZFIN ID:
ZDB-GENE-061207-43
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BIH3]
Human Orthologue:
HFM1
Human Description:
HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20193]
Mouse Orthologue:
Hfm1
Mouse Description:
HFM1, ATP-dependent DNA helicase homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:3036246]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19742 Nonsense Available for shipment Available now
sa44531 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32909 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19742
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099851 Nonsense 408 1049 11 29
ENSDART00000141518 Nonsense 533 977 14 26

The following transcripts of ENSDARG00000068922 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 23002243)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22887671
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAGCAACTGCAGTAATCATGACACGGCCTCAGACAAAGGACAAATA[C/A]ATGCATTTCTTGAGTGGCTTAGACTGCATAGAGAGCAGGTATACACCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099851 Essential Splice Site 778 1049 22 29
ENSDART00000141518 Essential Splice Site 887 977 24 26

The following transcripts of ENSDARG00000068922 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22994025)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATTGTTGGAGATTGTGACAATAAGGTGGTCTTCCAACAAAAAATCTC[G/A]TAAGTTCTATGTTATTTATTTGTCTTTAGCAAACCTTTTTTTTTTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099851 Nonsense 905 1049 26 29
ENSDART00000141518   None 977 None 26

The following transcripts of ENSDARG00000068922 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22987586)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22904241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGCCATTTCTTTTTTTAGGCAAAATTGGAGTCAAAAGGACTGTACTA[C/T]AGTCAAATGTCTCCTCATACCTTGACAACCTAAAAATGAGGAATGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link