nos1

Ensembl ID:
ENSDARG00000068910
ZFIN IDs:
ZDB-GENE-001101-1, ZDB-GENE-001101-1, ZDB-GENE-001101-1
Description:
nitric oxide synthase, brain [Source:RefSeq peptide;Acc:NP_571735]
Human Orthologue:
NOS1
Human Description:
nitric oxide synthase 1 (neuronal) [Source:HGNC Symbol;Acc:7872]
Mouse Orthologue:
Nos1
Mouse Description:
nitric oxide synthase 1, neuronal Gene [Source:MGI Symbol;Acc:MGI:97360]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33543 Essential Splice Site Available for shipment Available now
sa26415 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20353 Essential Splice Site Available for shipment Available now
sa14542 Essential Splice Site Available for shipment Available now
sa12337 Nonsense Available for shipment Available now
sa11824 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099810 Essential Splice Site 278 1431 2 28
ENSDART00000099822 Essential Splice Site 278 1431 2 28
ENSDART00000125435 Essential Splice Site 278 1431 2 28
Genomic Location (Zv9):
Chromosome 5 (position 13294196)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11705907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACAACATGCCCACGGTGCTTAACAACCCTTACTCAGAAAGTGACAAGG[T/C]AAAATACAGTCTAAATGGCTTTATGTGTGGCTTTGAAGGACTGTGAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099810 Essential Splice Site 505 1431 7 28
ENSDART00000099822 Essential Splice Site 505 1431 7 28
ENSDART00000125435 Essential Splice Site 505 1431 7 28
Genomic Location (Zv9):
Chromosome 5 (position 13251767)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11663049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCGATGGATCAATTCTAGGAGATCCAGCTTCTGTAGAGCTTACAGAG[G/A]TGAGATTGATGTCGTTTTGATTGTTAGGCTCACAGACACAACAAAAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099810 Essential Splice Site 709 1431 11 28
ENSDART00000099822 Essential Splice Site 709 1431 11 28
ENSDART00000125435 Essential Splice Site 709 1431 11 28
Genomic Location (Zv9):
Chromosome 5 (position 13234460)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11645742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACCAGGAAATGCTCAACTATCGCCTCACACCATCTTTTGAGTACCAG[G/A]TAAGGCTCTTGTCTATTTTAGAATGAAGTAGTATTGACTTTTAATTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099810 Essential Splice Site 709 1431 11 28
ENSDART00000099822 Essential Splice Site 709 1431 11 28
ENSDART00000125435 Essential Splice Site 709 1431 11 28
Genomic Location (Zv9):
Chromosome 5 (position 13234459)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11645741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCAGGAAATGCTCAACTATCGCCTCACACCATCTTTTGAGTACCAGG[T/C]AAGGCTCTTGTSTATTTTAGAATGAAGTAGTWWTGACTTTTAATTATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12337
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099810 Nonsense 749 1431 13 28
ENSDART00000099822 Nonsense 749 1431 13 28
ENSDART00000125435 Nonsense 749 1431 13 28
Genomic Location (Zv9):
Chromosome 5 (position 13229195)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11640476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTATGTATGATTTGCAGGGCTGTRAAGTTCTCCGCCAAACTCATGGGA[C/T]AAGCCATGGCCAAGAGAGTCAAAGCCACCATCTTATTCGCCACAGAAACR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099810 Nonsense 1285 1431 25 28
ENSDART00000099822 Nonsense 1285 1431 25 28
ENSDART00000125435 Nonsense 1285 1431 25 28
Genomic Location (Zv9):
Chromosome 5 (position 13196626)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11608029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTCAATCAGGAATCAAGGCTTGCCCCATGATCTTGGTGTTTGGTTG[T/A]CGGCAGTCCCAGATTGACCACATTTACAAGGAACAGACCATCCAAGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link