sdad1

Ensembl ID:
ENSDARG00000068903
ZFIN ID:
ZDB-GENE-021213-1
Description:
Protein SDA1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NV26]
Human Orthologue:
SDAD1
Human Description:
SDA1 domain containing 1 [Source:HGNC Symbol;Acc:25537]
Mouse Orthologue:
Sdad1
Mouse Description:
SDA1 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2140779]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29527 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14966 Essential Splice Site Available for shipment Available now
sa13304 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099795 Essential Splice Site 394 682 14 22
ENSDART00000142986   None 212 None 7
Genomic Location (Zv9):
Chromosome 21 (position 8923782)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9280376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATAACTTTGTTACAGACAGAAATTCAGGGGAGGTCATGACAGTTGGG[T/C]ATGTGCTATGTAAATATGAGTAACATACAATAAGGTTTAAATGTCTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099795 Essential Splice Site 452 682 16 22
ENSDART00000142986   None 212 None 7
Genomic Location (Zv9):
Chromosome 21 (position 8924142)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9280016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCTCTTCAGAGACCTCAATCCAAAGATGCTAACCAGAAAAGACAGGG[T/C]GAGAAGTGTTTGCAGTTTTATATYATATTAAAATTGATCAAATCATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099795 Nonsense 633 682 21 22
ENSDART00000142986   None 212 None 7
Genomic Location (Zv9):
Chromosome 21 (position 8929544)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 9274614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACTGACAGGAAGGAGTTTACCAAAAAGAGAGGTAAACTAAACCCGTA[T/A]GCCAGCACCAGTAACAAGGAGAAGAAACGGAAGAAGAACTTCATGATGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link