nrip1b

Ensembl ID:
ENSDARG00000068894
ZFIN ID:
ZDB-GENE-030131-4173
Description:
RIP140-B [Source:UniProtKB/TrEMBL;Acc:Q1L667]
Human Orthologue:
NRIP1
Human Description:
nuclear receptor interacting protein 1 [Source:HGNC Symbol;Acc:8001]
Mouse Orthologue:
Nrip1
Mouse Description:
nuclear receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1315213]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34964 Nonsense Mutation detected in F1 DNA During 2017
sa7287 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099799 Nonsense 380 1000 1 3
Genomic Location (Zv9):
Chromosome 10 (position 39626566)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38316537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACTGCAGCAGTCTGTTGCTTCTACTTCTTAACAATCACAACTCCCAA[C/T]AGCAGCTCACCAGAAACGGACACCTAGAGGAAGACTGCGGCATCCTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099799 Essential Splice Site 711 1000 2 3
Genomic Location (Zv9):
Chromosome 10 (position 39625539)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 38315510
KASP Assay ID:
554-4524.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAAGGGTGGNCTCTGCTAAGTGTGACAGCTCAAATGGACCTYCTCTGGA[C/G]CCTAACATCAAAAAGGAGCCAGTAGAAGAGAATCTTCAATCAGACCGCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link