adcy1a

Ensembl ID:
ENSDARG00000068890
ZFIN ID:
ZDB-GENE-070705-302
Description:
adenylate cyclase 1a [Source:RefSeq peptide;Acc:NP_001161821]
Human Orthologue:
ADCY1
Human Description:
adenylate cyclase 1 (brain) [Source:HGNC Symbol;Acc:232]
Mouse Orthologue:
Adcy1
Mouse Description:
adenylate cyclase 1 Gene [Source:MGI Symbol;Acc:MGI:99677]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17570 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099790 Nonsense 169 685 4 14
Genomic Location:
Chromosome 20 (position 6915882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATCAAATTGTCTTTGTCTTTTTCTGTCACACAGTACCAGCAAGTGTA[T/A]GATGATGCCTTCATCAGTGCGGTGGTTATCTCGCTAGTCCTCACTTCGKT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3afmybum