kbtbd10a

Ensembl ID:
ENSDARG00000068888
ZFIN ID:
ZDB-GENE-081105-22
Human Orthologue:
KBTBD10
Human Description:
kelch repeat and BTB (POZ) domain containing 10 [Source:HGNC Symbol;Acc:16905]
Mouse Orthologue:
Kbtbd10
Mouse Description:
kelch repeat and BTB (POZ) domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2683854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21598 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099787 Nonsense 552 599 5 6
Genomic Location (Zv9):
Chromosome 9 (position 49261005)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48576075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGCTTTATGCGGTCGCTGGATTCACGATAAAGGAGAACGAAGACAAA[C/T]AGTGTGTGCCGTCAGAAATCACAGACATCTGGCAGTAAGTCTTCTACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link