FBXO16 (2 of 2)

Ensembl ID:
ENSDARG00000068884
Description:
F-box protein 16 [Source:HGNC Symbol;Acc:13618]
Human Orthologue:
FBXO16
Human Description:
F-box protein 16 [Source:HGNC Symbol;Acc:13618]
Mouse Orthologue:
Fbxo16
Mouse Description:
F-box protein 16 Gene [Source:MGI Symbol;Acc:MGI:1354706]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32558 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099775 Nonsense 61 348 4 9
Genomic Location (Zv9):
Chromosome Zv9_scaffold3564 (position 136320)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 35345439
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAAGATTTTTTCTCCAGATGTTCTGCCGGCCAGCTGAAACATCTCAGA[C/T]AGACTCTGAGCAGCTGGGTACCAGAAGAAACCCTCGACTTCACCACGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link