si:ch211-250m6.7

Ensembl ID:
ENSDARG00000068874
ZFIN ID:
ZDB-GENE-041210-239
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RJ13]
Human Orthologue:
PTCHD3
Human Description:
patched domain containing 3 [Source:HGNC Symbol;Acc:24776]
Mouse Orthologue:
Ptchd3
Mouse Description:
patched domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1921925]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40342 Nonsense Mutation detected in F1 DNA During 2017
sa20320 Essential Splice Site Available for shipment Available now
sa17796 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099761 Nonsense 199 826 1 4
Genomic Location (Zv9):
Chromosome 4 (position 61361930)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76257976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAGAGACACAGCCAAACAGCTCAATGCTGAAAAGTGCCAAAGCGATC[A/T]GACTTTATTACTTCCTAGATGAGAAGAAGAGCAAGGGAAACGCAGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099761 Essential Splice Site 274 826 2 4
Genomic Location (Zv9):
Chromosome 4 (position 61361496)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76258410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCACATACGCCCTGGCCATCAACATTGCAGTTCTTTCTTGTTTGAG[G/C]TACGCAGTATTCAAATAATACTAATCTAAGTACCTAATCTAAGAGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099761 Nonsense 463 826 4 4
Genomic Location (Zv9):
Chromosome 4 (position 61360773)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76259133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAACAAGGAGCATGAAATGCCAATGGAAGTRTTCTTYAAGAAATATTA[T/A]GGCCCATTTCTGGCAAAGGTRYGGGTCAAGGTGCTYGTGTGTCTGATCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link