fance

Ensembl ID:
ENSDARG00000068870
ZFIN ID:
ZDB-GENE-060510-5
Description:
Fanconi anemia group E protein [Source:RefSeq peptide;Acc:NP_001035724]
Human Orthologue:
FANCE
Human Description:
Fanconi anemia, complementation group E [Source:HGNC Symbol;Acc:3586]
Mouse Orthologue:
Fance
Mouse Description:
Fanconi anemia, complementation group E Gene [Source:MGI Symbol;Acc:MGI:1920025]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9180 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099751 Nonsense 430 502 9 10
Genomic Location:
Chromosome 8 (position 24588939)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTTAGCTGTATGTTAATGATTTCTGTTGCTATCCTCACAGCTTGAGT[T/A]GAGTCAAGAGGATTTCTGTCTCTTCGCTGAGCATCTTTGCAGCCAGTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l2wdl97p