si:dkey-18a10.4

Ensembl ID:
ENSDARG00000068858
ZFIN IDs:
ZDB-GENE-080402-1, ZDB-GENE-091204-49
Description:
interleukin 2 receptor, gamma a [Source:RefSeq peptide;Acc:NP_001121743]
Human Orthologue:
IL2RG
Human Description:
interleukin 2 receptor, gamma [Source:HGNC Symbol;Acc:6010]
Mouse Orthologue:
Il2rg
Mouse Description:
interleukin 2 receptor, gamma chain Gene [Source:MGI Symbol;Acc:MGI:96551]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14683 Nonsense Available for shipment Available now
sa31788 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Nonsense 45 362 2 8
ENSDART00000131873 Nonsense 45 374 2 8
Genomic Location (Zv9):
Chromosome 10 (position 34582241)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33610099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAATCTGGACTATGTGAACTGCACATGGAGCGAACATCAGTACAATTA[C/A]AGTCTCAAGGGCGGGTATGTATTAMTGAAACAAGAAAGCATTTTNNTRAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099732 Nonsense 106 362 3 8
ENSDART00000131873 Nonsense 106 374 3 8
Genomic Location (Zv9):
Chromosome 10 (position 34581983)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33609841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGTACCGTGACGATGGCAGTTTGGTGACGGAACAGGAACATATGCTG[A/T]AAGAATATGGTATGAGAAGCCATTCGTTTCTTGCTTTCTCAAGATTTAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link