
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
f2rl1
- Ensembl ID:
- ENSDARG00000068856
- ZFIN ID:
- ZDB-GENE-061215-140
- Description:
- coagulation factor II (thrombin) receptor-like 1 [Source:RefSeq peptide;Acc:NP_001073273]
- Human Orthologue:
- F2RL1
- Human Description:
- coagulation factor II (thrombin) receptor-like 1 [Source:HGNC Symbol;Acc:3538]
- Mouse Orthologue:
- F2rl1
- Mouse Description:
- coagulation factor II (thrombin) receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:101910]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23853 | Nonsense | Available for shipment | Available now |
sa29513 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa23853
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099733 | Nonsense | 330 | 380 | 2 | 2 |
ENSDART00000136671 | None | 270 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 7208676)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 7329889 GRCz11 21 7935110 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTGGCCAGTCTGAACAGCTGTGTTGATCCATTCGTGTATTATTTTATCT[C/A]GGATGAATTCAGGGAGCATGTTAGAAACACTTTTCTTTGCCGAAGTGAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29513
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000099733 | Nonsense | 361 | 380 | 2 | 2 |
ENSDART00000136671 | None | 270 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 7208582)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 7329795 GRCz11 21 7935016 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTGAGCGCACTGCCCAGAGAATGCGAGTTTCTTTTAGTGCGCTGAAGTA[T/G]TCGAAGAAAAGCAGCACGTACACATCAGACTCTGGAAACACACAGAGCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: