f2rl1

Ensembl ID:
ENSDARG00000068856
ZFIN ID:
ZDB-GENE-061215-140
Description:
coagulation factor II (thrombin) receptor-like 1 [Source:RefSeq peptide;Acc:NP_001073273]
Human Orthologue:
F2RL1
Human Description:
coagulation factor II (thrombin) receptor-like 1 [Source:HGNC Symbol;Acc:3538]
Mouse Orthologue:
F2rl1
Mouse Description:
coagulation factor II (thrombin) receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:101910]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23853 Nonsense Mutation detected in F1 DNA During 2014
sa3147 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099733 Nonsense 330 380 2 2
ENSDART00000136671 None None 270 None 3
Genomic Location:
Chromosome 21 (position 7208676)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGCCAGTCTGAACAGCTGTGTTGATCCATTCGTGTATTATTTTATCT[C/A]GGATGAATTCAGGGAGCATGTTAGAAACACTTTTCTTTGCCGAAGTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099733 Nonsense 353 380 2 2
ENSDART00000136671 None None 270 None 3
Genomic Location:
Chromosome 21 (position 7208608)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTAGAAACACTTTTCTTTGCCGAAGTGAGCGCACTGCCCAGAGAATG[C/T]GAGTTTCTTTTAGTGCKCTGAAGTATTCGAAGAAAAGCAGCACGTACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/846jp0of