f2rl1

Ensembl ID:
ENSDARG00000068856
ZFIN ID:
ZDB-GENE-061215-140
Description:
coagulation factor II (thrombin) receptor-like 1 [Source:RefSeq peptide;Acc:NP_001073273]
Human Orthologue:
F2RL1
Human Description:
coagulation factor II (thrombin) receptor-like 1 [Source:HGNC Symbol;Acc:3538]
Mouse Orthologue:
F2rl1
Mouse Description:
coagulation factor II (thrombin) receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:101910]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23853 Nonsense Mutation detected in F1 DNA During 2015
sa3147 Nonsense Mutation detected in F1 DNA During 2015
sa29513 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa23853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099733 Nonsense 330 380 2 2
ENSDART00000136671   None 270 None 3
Genomic Location:
Chromosome 21 (position 7208676)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGCCAGTCTGAACAGCTGTGTTGATCCATTCGTGTATTATTTTATCT[C/A]GGATGAATTCAGGGAGCATGTTAGAAACACTTTTCTTTGCCGAAGTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099733 Nonsense 353 380 2 2
ENSDART00000136671   None 270 None 3
Genomic Location:
Chromosome 21 (position 7208608)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTAGAAACACTTTTCTTTGCCGAAGTGAGCGCACTGCCCAGAGAATG[C/T]GAGTTTCTTTTAGTGCKCTGAAGTATTCGAAGAAAAGCAGCACGTACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099733 Nonsense 361 380 2 2
ENSDART00000136671   None 270 None 3
Genomic Location:
Chromosome 21 (position 7208582)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGAGCGCACTGCCCAGAGAATGCGAGTTTCTTTTAGTGCGCTGAAGTA[T/G]TCGAAGAAAAGCAGCACGTACACATCAGACTCTGGAAACACACAGAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/846jp0of