si:ch211-163l21.10

Ensembl ID:
ENSDARG00000068855
ZFIN ID:
ZDB-GENE-081105-138
Description:
Uncharacterized protein C14orf45 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08C53]
Human Orthologue:
C14orf45
Human Description:
chromosome 14 open reading frame 45 [Source:HGNC Symbol;Acc:19855]
Mouse Orthologue:
2900006K08Rik
Mouse Description:
RIKEN cDNA 2900006K08 gene Gene [Source:MGI Symbol;Acc:MGI:1920123]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41200 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099724 Nonsense 157 520 4 12
Genomic Location (Zv9):
Chromosome 8 (position 24664795)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23790613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGTGACTTCCAGAGAATGCAGGGCGAACTCAAAACCATAAAACATTA[T/G]CGCAAAATAAAAGCCAATCTGGAAGAAGACCTGATCAGTGTAATGCATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link