h2afv

Ensembl ID:
ENSDARG00000068820
ZFIN ID:
ZDB-GENE-020717-1
Description:
Histone H2A.V [Source:UniProtKB/Swiss-Prot;Acc:Q71PD7]
Human Orthologue:
H2AFV
Human Description:
H2A histone family, member V [Source:HGNC Symbol;Acc:20664]
Mouse Orthologue:
H2afv
Mouse Description:
H2A histone family, member V Gene [Source:MGI Symbol;Acc:MGI:1924855]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40373 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099660 Nonsense 85 128 4 5
ENSDART00000139199   None 120 None 3
Genomic Location (Zv9):
Chromosome 5 (position 14856565)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 13150423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGGCAGGAAATGCTTCAAAAGACCTGAAGGTGAAGCGCATCACTCCT[C/T]GACATTTACAGCTGGCCATTCGAGGAGATGAGGAGCTCGATTCCCTTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link