tlr7

Ensembl ID:
ENSDARG00000068812
ZFIN ID:
ZDB-GENE-040219-11
Description:
Toll-like receptor 7 [Source:UniProtKB/TrEMBL;Acc:Q6TQH6]
Human Orthologue:
TLR7
Human Description:
toll-like receptor 7 [Source:HGNC Symbol;Acc:15631]
Mouse Orthologue:
Tlr7
Mouse Description:
toll-like receptor 7 Gene [Source:MGI Symbol;Acc:MGI:2176882]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7215 Nonsense Mutation detected in F1 DNA During 2016
sa41556 Nonsense Mutation detected in F1 DNA During 2016
sa11566 Nonsense Available for shipment Available now
sa31752 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 378 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56164815)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54579199
KASP Assay ID:
554-4709.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATCTTTCAGTCAGCTTAAATCWCTTAGAGTGCTAAGAATCAGAGGATA[T/A]GTGTTTCAAGAACTCAAATTGCAAGACATCCAACCGCTAACTAACTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 768 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56165983)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54580367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCTCAAAATCCTAGATCTCAGTTACAATTCCATCCAGTTTATCGAT[G/T]AATCAAGCTTCCCGGAAAATGTTATAGACCATCTGCAAACTCTTTACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 952 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56166535)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54580919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATTGGGTTCCTGGATGTCCACTTATTGAGMATCTTTCCCAAAGTATA[C/T]AGTTGAGCCAGCGTACGGTTTTCATCCTGACTGAGAGGTATATAAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130393 Nonsense 1019 1051 1 1
Genomic Location (Zv9):
Chromosome 9 (position 56166737)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54581121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATATCTCAGACTGAGGAAGAGGTTGTATAAAAAGTCAGTTTTGGAGT[G/A]GCCAAGGAACCCACAGGCACAAAGGTACTTTTGGTTCAGTCTCAGAAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link