si:ch211-230g14.3

Ensembl ID:
ENSDARG00000068742
ZFIN ID:
ZDB-GENE-081104-529
Description:
hypothetical protein LOC569890 [Source:RefSeq peptide;Acc:NP_001116175]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40379 Nonsense Mutation detected in F1 DNA During 2017
sa20367 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40379
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099545 Nonsense 184 414 2 2
Genomic Location (Zv9):
Chromosome 5 (position 17465157)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15191117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATTTACCTGAACATCCTGAAGTTCTCGTTCTCCCAGCCTCTCGCCTC[A/T]AAGCCTCAAGTCCTCAAACGCCTGCTGAGGAACCTGAGCACCTGCTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099545 Nonsense 322 414 2 2
Genomic Location (Zv9):
Chromosome 5 (position 17464743)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15190703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGCGGATGGAGGCCTGGTTGGAGCAGGAGGAAGTTACGGAGGTCCAG[A/T]AACATGAAGAAAAGGGAGCCTCGCAGGTCATACAAAACCCACTTAATGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link