NP_001122277.1

Ensembl ID:
ENSDARG00000068735
Description:
similar to coxsackie adenovirus receptor-like [Source:RefSeq peptide;Acc:NP_001122277]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30426 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30427 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38211 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30426
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127160 Essential Splice Site 3 164 1 4
ENSDART00000127160 Essential Splice Site 3 164 1 4
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 109505)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5056954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAACGGCTTACTGAGACGGATTACACGCAGGCTGCAATATGTACCGG[T/C]AAGACCTTTTTCCAATTTAAATTAAAACATCACGGTCGAAATTAACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127160 Essential Splice Site 3 164 1 4
ENSDART00000127160 Essential Splice Site 3 164 1 4
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 109505)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5056954
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAACGGCTTACTGAGACGGATTACACGCAGGCTGCAATATGTACCGG[T/C]AAGACCTTTTTCCAATTTAAATTAAAACATCACGGTCGAAATTAACAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127160 Nonsense 83 164 3 4
Genomic Location (Zv9):
Chromosome Zv9_NA735 (position 114425)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5052034
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTCTGTAAAGGAACAACATCCAGCATACAACAGCAGAGCTGAAGTGT[T/A]AGATGAGCGACTGGAGAAGGGCCACATTGAACTCAAACTCACCAACCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link