si:ch211-124k10.1

Ensembl ID:
ENSDARG00000068731
ZFIN ID:
ZDB-GENE-060531-8
Description:
Novel protein similar to vertebrate leucine-rich repeat-containing G protein-coupled receptor family
Human Orthologue:
RXFP2
Human Description:
relaxin/insulin-like family peptide receptor 2 [Source:HGNC Symbol;Acc:17318]
Mouse Orthologue:
Rxfp2
Mouse Description:
relaxin/insulin-like family peptide receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2153463]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38488 Nonsense Mutation detected in F1 DNA During 2017
sa40494 Nonsense Mutation detected in F1 DNA During 2017
sa13404 Nonsense Available for shipment Available now
sa2221 Nonsense F2 line generated During 2017
sa40493 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113765 Nonsense 166 393 6 15
ENSDART00000143448 Nonsense 96 622 4 16
Genomic Location (Zv9):
Chromosome 5 (position 37524862)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35306811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGTATAGAAACGATCTCCAAGAGGGCATTTTCAGGACTGGTCGCTT[T/A]GCGTAAACTGTGAGTAATCTGTGAATGAATGACTCACTTAATGTGTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113765 Nonsense 372 393 15 15
ENSDART00000143448 Nonsense 302 622 13 16
Genomic Location (Zv9):
Chromosome 5 (position 37506308)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35288257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTTGAACAATTTCAGTTATTTCAAGCGTTTTGAATTCTGTGGATA[T/A]TCTCCAAATGTGCGGAGCTGCAAACCAAACACAGACGGAATCTCATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113765   None 393 None 15
ENSDART00000143448 Nonsense 342 622 13 16
Genomic Location (Zv9):
Chromosome 5 (position 37506190)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35288139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCATTCTGCGGGTGTTTGTCTGGGTWGTCGCCTTCATCATTTGCTTC[G/T]GAAACATCTTCGTCATCTGTCTGCGGTCCTGTATTKCTTCAGAGAATYAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2221
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113765   None 393 None 15
ENSDART00000143448 Nonsense 358 622 13 16
Genomic Location (Zv9):
Chromosome 5 (position 37506142)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35288091
KASP Assay ID:
554-2779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGAAACATCTTCGTCATCTGTCTGCGGTCCTGTATTGCTTCAGAGAAT[C/T]AACATCACACCATGGCCATCAAATCCCTTTGCTGTGAGTCTATTATACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113765   None 393 None 15
ENSDART00000143448 Nonsense 612 622 16 16
Genomic Location (Zv9):
Chromosome 5 (position 37493018)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 35274967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCATCCTGTACACAATCACAACCAGCGCGTTTCAGCAGCGACTTAAA[C/T]AGTGTCTGAAATATCGCTGCCAGCAGACTAACTGACACAAACACACACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link