LOC100148564

Ensembl ID:
ENSDARG00000068719
Human Orthologue:
RP11-332P22.1
Human Description:
Geminin coiled-coil domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:A6NCL1]
Mouse Orthologue:
Gm606
Mouse Description:
predicted gene 606 Gene [Source:MGI Symbol;Acc:MGI:2685452]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22699 Nonsense Mutation detected in F1 DNA During 2014
sa6391 Nonsense Mutation detected in F1 DNA During 2014
sa470 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa22699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099496 Nonsense 116 382 3 4
Genomic Location:
Chromosome 15 (position 35578889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAACAACAAGCTCAAAGAGTTTCTAAACTCGTCATATGTGAAGTCTT[T/A]GGAGGAAAAATCTAAGGTAAGAAACCTCTCAATTTGTCACAGATATTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099496 Nonsense 118 382 3 4
Genomic Location:
Chromosome 15 (position 35578894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAAGCTCAAAGAGTTTYTAAACTCGTCWTATGTGAAGTCTTTGGAG[G/T]AAAAAWCTAAGGTRAGAAACCTCTCAATTTGTNNCAGATATTAAYACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa470
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099496 Nonsense 349 382 4 4
Genomic Location:
Chromosome 15 (position 35584309)
KASP Assay ID:
554-0202.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGTCCCGTAGCAAGACAGATTTAGCATTTAGCATGTCACTAAGTCCA[C/T]AAAACAGTGTGAAGACGCACAGTTTCCCTCAAGGACAAGCTTTCACACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uk7kc8y0