si:dkey-174l22.2

Ensembl ID:
ENSDARG00000068714
ZFIN ID:
ZDB-GENE-091113-34
Human Orthologue:
KSR1
Human Description:
kinase suppressor of ras 1 [Source:HGNC Symbol;Acc:6465]
Mouse Orthologue:
Ksr1
Mouse Description:
kinase suppressor of ras 1 Gene [Source:MGI Symbol;Acc:MGI:105051]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17595 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099482 Nonsense 33 970 1 20
ENSDART00000136510   None 105 None 4
ENSDART00000137636 Nonsense 88 1019 1 18
Genomic Location (Zv9):
Chromosome 10 (position 38516116)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37239131
KASP Assay ID:
2260-3550.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGGACAGCGGCGGCGGTGGCGCAGCGATGGCCGCGCTACACCAGTG[C/A]GAAYTGATCCAGAACATGATCGACATCTCCATCTCCAGTTTGCAAGGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link