crfb4

Ensembl ID:
ENSDARG00000068711
ZFIN ID:
ZDB-GENE-070905-3
Description:
interleukin-10 receptor subunit beta [Source:RefSeq peptide;Acc:NP_001077337]
Human Orthologues:
AP000295.9, IFNGR2, IL10RB
Human Descriptions:
interferon gamma receptor 2 (interferon gamma transducer 1) [Source:HGNC Symbol;Acc:5440]
interleukin 10 receptor, beta [Source:HGNC Symbol;Acc:5965]
Mouse Orthologues:
Ifngr2, Il10rb
Mouse Descriptions:
interferon gamma receptor 2 Gene [Source:MGI Symbol;Acc:MGI:107654]
interleukin 10 receptor, beta Gene [Source:MGI Symbol;Acc:MGI:109380]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21454 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099479 Essential Splice Site 269 313 6 7
ENSDART00000127448 Essential Splice Site 269 313 6 7
Genomic Location:
Chromosome 9 (position 16650288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGAATTGTATTCCCTAATGATAATCTGCCAGAGCATCTAAAACAGG[T/A]AGCAAAATTATAAAAGGCAACTGACTTACTGTTAATCTGTTACTGACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study on a southern European population identifies a new Crohn's disease susceptibility locus at RBX1-EP300. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/geth0cmr