nid1a

Ensembl ID:
ENSDARG00000068710
ZFIN ID:
ZDB-GENE-050302-58
Description:
Novel protein similar to H.sapiens nidogen [Source:UniProtKB/TrEMBL;Acc:B8JKX1]
Human Orthologue:
NID1
Human Description:
nidogen 1 [Source:HGNC Symbol;Acc:7821]
Mouse Orthologue:
Nid1
Mouse Description:
nidogen 1 Gene [Source:MGI Symbol;Acc:MGI:97342]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35599 Nonsense Mutation detected in F1 DNA During 2017
sa8991 Essential Splice Site Mutation detected in F1 DNA During 2017
sa15334 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa35599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099475 Nonsense 80 1269 2 29
ENSDART00000133308   None 578 None 12
Genomic Location (Zv9):
Chromosome 13 (position 51106718)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49817815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATGGCTTTGTTGCTCTGGAGAAGCCGACAGGAGAATCGGAGTATCTG[G/T]AAAACATGCCGGCCAGTTTTAAAATGATCGCAGCTCTTCAAGGCGACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099475 Essential Splice Site 645 1269 14 29
ENSDART00000133308   None 578 None 12
Genomic Location (Zv9):
Chromosome 13 (position 51084004)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49795101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCTCTTTCAATGYGTCTCAGGATAAACCWATTAATATTTCTTYCACA[T/A]CMACAGGTGGACAAAGTGAAGAAAACGCCTGTTTTACTGGCAGACACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099475 Essential Splice Site 784 1269 None 29
ENSDART00000133308 Essential Splice Site 137 578 3 12
Genomic Location (Zv9):
Chromosome 13 (position 51079356)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 49790453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTGCACCTGTGCACCGGGATTCATGGGAGATGGCAGACGCTGTCARG[G/A]TGGGTCAGACTWCRGAAAACTCATACTCCARTAAAAGTACCGTGACTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cutaneous nevi: Genome-wide association study identifies nidogen 1 (NID1) as a susceptibility locus to cutaneous nevi and melanoma risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link