tmem168a

Ensembl ID:
ENSDARG00000068705
ZFIN ID:
ZDB-GENE-050419-97
Description:
Transmembrane protein 168-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LUD1]
Human Orthologue:
TMEM168
Human Description:
transmembrane protein 168 [Source:HGNC Symbol;Acc:25826]
Mouse Orthologue:
Tmem168
Mouse Description:
transmembrane protein 168 Gene [Source:MGI Symbol;Acc:MGI:1921794]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11468 Nonsense Available for shipment Available now
sa6927 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099464 Nonsense 452 681 3 4
Genomic Location:
Chromosome 4 (position 6133020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCAGCGACTCTTCTCCCATCACCTTATCCAGACGTTCGGGTGTGACTA[T/A]TCCACCAGTCTAAGCCTCGAGACCCTGCTTGTCAAGCTGCGCTCCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099464 Nonsense 600 681 4 4
Genomic Location:
Chromosome 4 (position 6137985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGYGGCGTSCAGTGGTCTGAGAGAGGAAGGGTCATATCGGCTATATA[T/A]GGAGTCTCCAAACCCTGGAGCGACTATGCCCTTCACCTGCCCACCGGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8xbary5o