or108-1

Ensembl ID:
ENSDARG00000068704
ZFIN ID:
ZDB-GENE-070804-4
Description:
odorant receptor, family D, subfamily 108, member 1 [Source:RefSeq peptide;Acc:NP_001122041]
Human Orthologues:
OR2AT4, OR6K2, OR6K3, OR6K6, OR6N1, OR6N2
Human Descriptions:
olfactory receptor, family 2, subfamily AT, member 4 [Source:HGNC Symbol;Acc:19620]
olfactory receptor, family 6, subfamily K, member 2 [Source:HGNC Symbol;Acc:15029]
olfactory receptor, family 6, subfamily K, member 3 [Source:HGNC Symbol;Acc:15030]
olfactory receptor, family 6, subfamily K, member 6 [Source:HGNC Symbol;Acc:15033]
olfactory receptor, family 6, subfamily N, member 1 [Source:HGNC Symbol;Acc:15034]
olfactory receptor, family 6, subfamily N, member 2 [Source:HGNC Symbol;Acc:15035]
Mouse Orthologues:
Olfr231, Olfr420, Olfr421, Olfr424, Olfr427, Olfr429, Olfr430, Olfr520, Olfr521
Mouse Descriptions:
olfactory receptor 231 Gene [Source:MGI Symbol;Acc:MGI:3030065]
olfactory receptor 420 Gene [Source:MGI Symbol;Acc:MGI:3030254]
olfactory receptor 421 Gene [Source:MGI Symbol;Acc:MGI:3030255]
olfactory receptor 424 Gene [Source:MGI Symbol;Acc:MGI:3030258]
olfactory receptor 427 Gene [Source:MGI Symbol;Acc:MGI:3030261]
olfactory receptor 429 Gene [Source:MGI Symbol;Acc:MGI:3030263]
olfactory receptor 430 Gene [Source:MGI Symbol;Acc:MGI:3030264]
olfactory receptor 520 Gene [Source:MGI Symbol;Acc:MGI:3030354]
olfactory receptor 521 Gene [Source:MGI Symbol;Acc:MGI:3030355]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18054 Nonsense Available for shipment Available now
sa21782 Nonsense Mutation detected in F1 DNA During 2014
sa4383 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019415 Nonsense 136 313 2 2
ENSDART00000076810 Nonsense 135 312 2 2
Genomic Location:
Chromosome 10 (position 37375261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCCTGTGTATTCTCTCTTATGACCGGTTCATTGCCATCTGYTTTCCTT[T/A]AAGACACGAATCCATAAACACAAACACCAGAATGACTTATATTATCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019415 Nonsense 155 313 2 2
ENSDART00000076810 Nonsense 154 312 2 2
Genomic Location:
Chromosome 10 (position 37375319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCCATAAACACAAACACCAGAATGACTTATATTATCTGTGTAAGCTG[G/A]TTCCTTTCTTTTAGTATATCACTATACGGCACTTTATCCATCCCAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019415 Nonsense 229 313 2 2
ENSDART00000076810 Nonsense 228 312 2 2
Genomic Location:
Chromosome 10 (position 37375541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGCTGTACCTTTGTGTTTTATTTTCCTGACATATATGTTTATTCTGTA[T/A]GCTGTATTCAGAATGAATAACAATCAGCGCCGGTTTAAGGCTCTGGCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mruqxbuq