gpr85

Ensembl ID:
ENSDARG00000068701
ZFIN ID:
ZDB-GENE-000710-2
Description:
Probable G protein-coupled receptor 85 [Source:UniProtKB/Swiss-Prot;Acc:Q9I919]
Human Orthologue:
GPR85
Human Description:
G protein-coupled receptor 85 [Source:HGNC Symbol;Acc:4536]
Mouse Orthologue:
Gpr85
Mouse Description:
G protein-coupled receptor 85 Gene [Source:MGI Symbol;Acc:MGI:1927851]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2156 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2156
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099462 Nonsense 60 377 2 2
Genomic Location (Zv9):
Chromosome 4 (position 6033936)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 6636480
KASP Assay ID:
554-2786.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGAAACCTCCTGATATCCATCCTGCTGGTCAAAGACAAGAGCCTTCAT[C/T]GAGCGCCCKACTACTTCCTGCTGGACCTCTGTGCTTCGGACATCCTCCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link