kctd4

Ensembl ID:
ENSDARG00000068691
ZFIN ID:
ZDB-GENE-040704-71
Description:
potassium channel tetramerisation domain containing 4 [Source:RefSeq peptide;Acc:NP_001002224]
Human Orthologue:
KCTD4
Human Description:
potassium channel tetramerisation domain containing 4 [Source:HGNC Symbol;Acc:23227]
Mouse Orthologue:
Kctd4
Mouse Description:
potassium channel tetramerisation domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1914766]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14491 Nonsense Available for shipment Available now
sa980 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099446 Nonsense 13 258 1 1
Genomic Location:
Chromosome 9 (position 19495471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGAGGAACGGAATGGAATGGAACCTCAGAAGGATGGAGAGCGAACTG[A/T]GACAGATCAATCCGGACCTGCTGCAGCCCAGCAAGAGCTTTAAGAAWCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099446 Nonsense 165 258 1 1
Genomic Location:
Chromosome 9 (position 19495015)
KASP Assay ID:
554-0885.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAGCGCTCACAGGGTCTGAGAGTCTACTGCAGCGACAACACCTTCATC[G/T]AGAAGGTCAAGAACCGGCTGGTACAGATCTCSAAGAGTCGCCTGGACGGC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f1x7lnzx