chmp2b

Ensembl ID:
ENSDARG00000068683
ZFIN ID:
ZDB-GENE-070628-3
Description:
chromatin modifying protein 2B [Source:RefSeq peptide;Acc:NP_001116769]
Human Orthologue:
CHMP2B
Human Description:
chromatin modifying protein 2B [Source:HGNC Symbol;Acc:24537]
Mouse Orthologue:
Chmp2b
Mouse Description:
chromatin modifying protein 2B Gene [Source:MGI Symbol;Acc:MGI:1916192]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34606 Nonsense Mutation detected in F1 DNA During 2017
sa31708 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055866 Nonsense 64 216 3 6
Genomic Location (Zv9):
Chromosome 9 (position 19666161)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19040403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAATGGCCAAGACTGGAAACCGTGAAGCCTGCAAAATATTAGCCAAA[C/T]AGCTCGTACAGCTTCGAAAACAAAAGAACCGAACCTACGCTGTGAGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055866 Nonsense 71 216 3 6
Genomic Location (Zv9):
Chromosome 9 (position 19666182)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19040424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGTGAAGCCTGCAAAATATTAGCCAAACAGCTCGTACAGCTTCGAAAA[C/T]AAAAGAACCGAACCTACGCTGTGAGCTCTAAAGTCACATCCATGTCCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link