crfb1

Ensembl ID:
ENSDARG00000068681
ZFIN ID:
ZDB-GENE-030131-8673
Description:
cytokine receptor family member b1 [Source:RefSeq peptide;Acc:NP_001073149]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa285 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa285
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099426 Nonsense 41 546 4 10
ENSDART00000110457 Nonsense 41 546 2 8
ENSDART00000137087 Nonsense 41 425 4 8

The following transcripts of ENSDARG00000068681 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 19719760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCTCCTGTCAACTTTACAATATGGTCTCACAACTTCAGACACATTT[T/A]ACACTGGAATTATGGGGTAAATTCTCCTCCACAGAGCGTTTTCAATTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yq8ap06y