ctrl

Ensembl ID:
ENSDARG00000068680
ZFIN ID:
ZDB-GENE-040912-147
Description:
chymotrypsin-like [Source:RefSeq peptide;Acc:NP_001004582]
Human Orthologue:
CTRL
Human Description:
chymotrypsin-like [Source:HGNC Symbol;Acc:2524]
Mouse Orthologue:
Ctrl
Mouse Description:
chymotrypsin-like Gene [Source:MGI Symbol;Acc:MGI:88558]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35969 Nonsense Mutation detected in F1 DNA During 2016
sa22706 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099425 Nonsense 172 261 6 7

The following transcripts of ENSDARG00000068680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 36521944)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37921948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTAGATTTTCTTCTTTTGTTTTCACAGCAAGCCCTCGTATCCTGCAG[C/T]AGACCGCATTGCCTCTTCTGAGTCCAGCTCAGTGTAAGCAATACTGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22706
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099425 Nonsense 223 261 7 7

The following transcripts of ENSDARG00000068680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 36519440)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 37919444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGGGTGATTCTGGTGGTCCTCTGGTGTGTGAGAGCTCAGGTGCTTG[G/A]TATCAGGTTGGCATCGTGTCCTGGGGCACCAGTGACTGCAATGTTCGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link