si:ch211-222m18.3

Ensembl ID:
ENSDARG00000068678
ZFIN ID:
ZDB-GENE-050419-109
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQH2]
Human Orthologue:
IQCG
Human Description:
IQ motif containing G [Source:HGNC Symbol;Acc:25251]
Mouse Orthologue:
Iqcg
Mouse Description:
IQ motif containing G Gene [Source:MGI Symbol;Acc:MGI:1916957]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9928 Nonsense Available for shipment Available now
sa39203 Nonsense Mutation detected in F1 DNA During 2017
sa25066 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39202 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099423 Nonsense 136 346 4 9
ENSDART00000142068 Nonsense 68 278 3 8
Genomic Location (Zv9):
Chromosome 18 (position 27803358)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27876210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTATACCCTATTTTACATCTAGGGAGGAAGAAGGTYGTCGCCAGATT[A/T]AAAAACTGCAAAAGCAGTTACTTGACATTCGCAAAGAAAAAACAGAGGAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099423 Nonsense 177 346 5 9
ENSDART00000142068 Nonsense 109 278 4 8
Genomic Location (Zv9):
Chromosome 18 (position 27803065)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27875917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCATCCTAAAAGACCAGGTACAGGACATGAGGGTGAGGACAAACCAA[C/T]AAGGGAAATTTGTGAAGAGCTGTGCTGAACAGCTGGTCTACCAGGAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099423 Essential Splice Site 209 346 6 9
ENSDART00000142068 Essential Splice Site 141 278 5 8
Genomic Location (Zv9):
Chromosome 18 (position 27801173)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27874025
KASP Assay ID:
554-7378.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATACCATAACATTGTAATTTATTAATTCCACTTTTGGTTGTGCACTCA[G/A]ATGCTTCAAGAGAAAATTGAGGAGGAAAAGAATGTCCACTTTGAAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099423 Nonsense 334 346 9 9
ENSDART00000142068 Nonsense 266 278 8 8
Genomic Location (Zv9):
Chromosome 18 (position 27792857)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27865709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGACTCTTGTTCGCAAAGGACCACGTTCCAAGAAAGCAGATAAATCC[A/T]AGAAAAAAGATGGGAAAAAGGGCAAAAAGAAGAGGAAGTAATGACTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link