rhoga

Ensembl ID:
ENSDARG00000068653
ZFIN ID:
ZDB-GENE-060503-820
Description:
hypothetical protein LOC556424 [Source:RefSeq peptide;Acc:NP_001076273]
Human Orthologue:
RHOG
Human Description:
ras homolog gene family, member G (rho G) [Source:HGNC Symbol;Acc:672]
Mouse Orthologue:
Rhog
Mouse Description:
ras homolog gene family, member G Gene [Source:MGI Symbol;Acc:MGI:1928370]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12151 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099388 Nonsense 74 191 1 1
Genomic Location:
Chromosome 15 (position 36900796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACAGCAGGACAGGAGGAGTACGACCGTTTRCGTACTCTTTCTTACCCA[C/T]AGACCAACATCTTCATCRTCTGTTTCAGCGTCACCAGTCCTCCATCTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h39jqqlw