si:dkey-21n12.3

Ensembl ID:
ENSDARG00000068640
ZFIN ID:
ZDB-GENE-091204-206
Human Orthologue:
RSF1
Human Description:
remodeling and spacing factor 1 [Source:HGNC Symbol;Acc:18118]
Mouse Orthologue:
Rsf1
Mouse Description:
remodeling and spacing factor 1 Gene [Source:MGI Symbol;Acc:MGI:2682305]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34954 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27652 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa31793 Nonsense Available for shipment Available now
sa10481 Nonsense Available for shipment Available now
sa15230 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077161 Essential Splice Site 187 1369 4 22
ENSDART00000135302   None 113 None 3
ENSDART00000138344   None 707 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37875617)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36687778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAAGAGCAGGATGATTTGGATGGGTCGTCCTGGAAATGTATAGTAAG[G/A]TAGGCATTCTGCATTTAATTTTTGTCCTCTTATTATGCCTTTTTGAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077161 Splice Site None 1369 None 22
ENSDART00000135302   None 113 None 3
ENSDART00000138344 Nonsense 270 707 6 11
Genomic Location (Zv9):
Chromosome 10 (position 37862932)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36675093
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATAACATTTTTTGAAGGTTGAAGTGGAGGAAGAAAAGGAAGAGGTTT[T/A]GGTTAAGGATAAAGCGGAGACGAAGAAGAGCAAAGGCTGGGGACGGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077161 Nonsense 1125 1369 19 22
ENSDART00000135302   None 113 None 3
ENSDART00000138344 Nonsense 441 707 9 11
Genomic Location (Zv9):
Chromosome 10 (position 37859957)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36672118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATCGTGCGAACAGAAGGAAAACGAGCCGGAGTCGAATCCGGAGAAAA[C/T]AACCTCCGCGCAGGAGACGCAGACCCAGAGGATACTCTGATGAAGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077161 Nonsense 1309 1369 22 22
ENSDART00000135302   None 113 None 3
ENSDART00000138344 Nonsense 647 707 11 11
Genomic Location (Zv9):
Chromosome 10 (position 37857301)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36669462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTYCCAGTCCAATAAACGACAACACAGCGGAGCCTCCYTCTACTAATGGA[C/T]AGAGCCCTATAAAGGGTCTGGAGGGCGTCGYGCCACGGCCGGGAGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077161 Nonsense 1362 1369 22 22
ENSDART00000135302   None 113 None 3
ENSDART00000138344 Nonsense 700 707 11 11
Genomic Location (Zv9):
Chromosome 10 (position 37857140)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36669301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGAAGAAGACGARGACGATCTTTTGGGCGTCACAGACCTCGTAGACTA[T/A]GTCTGCAACAGCGAACAGTTATAACCTGGCATTCATCTTCATCTTTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link