ENSDARG00000068637

Ensembl ID:
ENSDARG00000068637

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32059 Nonsense Available for shipment Available now
sa35977 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115257 Nonsense 1184 2813 19 34
Genomic Location (Zv9):
Chromosome 15 (position 38791823)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40307610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTATCTTTGAAACTGATTTTACAACAAGCCAAAAGCAATGTGAGATA[T/A]GTGGTGCAGTACAGGGCTTTGGAAAATGATGGAAAGAACTACACATCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35977
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115257 Nonsense 2501 2813 30 34
Genomic Location (Zv9):
Chromosome 15 (position 38777908)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 40293695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACAGGTTGAGTCCGAGTCTCACTCTGTCCATCATTATGGAAATTTAT[G/T]AGAGTCGTTTTCCTGAGTATGTGTCCAGTCTAATGAGTTCAGCAGGGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link