cd151l

Ensembl ID:
ENSDARG00000068629
ZFIN ID:
ZDB-GENE-040426-1868
Description:
CD151 antigen [Source:RefSeq peptide;Acc:NP_991213]
Human Orthologue:
CD151
Human Description:
CD151 molecule (Raph blood group) [Source:HGNC Symbol;Acc:1630]
Mouse Orthologue:
Cd151
Mouse Description:
CD151 antigen Gene [Source:MGI Symbol;Acc:MGI:1096360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39205 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099333 Nonsense 18 210 2 6

The following transcripts of ENSDARG00000068629 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 30944133)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31021608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGCAAATGAAGAGAAGAAGGAAAAATGTGGGACCATCTGCCTGAAATA[T/A]CTCCTTTTCACATTCAATTTTCTGTTTTGGGTTGGTATCTCTTAAGTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link