rab8b

Ensembl ID:
ENSDARG00000068628
ZFIN ID:
ZDB-GENE-070620-16
Description:
ras-related protein Rab-8B [Source:RefSeq peptide;Acc:NP_001092729]
Human Orthologue:
RAB8B
Human Description:
RAB8B, member RAS oncogene family [Source:HGNC Symbol;Acc:30273]
Mouse Orthologue:
Rab8b
Mouse Description:
RAB8B, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:2442982]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20960 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099327 Essential Splice Site 160 209 6 8
Genomic Location (Zv9):
Chromosome 7 (position 30644624)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29036966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCAAGTTCTTGGAAACCAGTGCAAAATCTAGCACAAATGTTGAAGAG[G/A]TGGGTTGAACCACTAAATTGAGTTTTTGCTTAGATTTGCATGTTTCAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link